Sentence examples for underlined and from inspiring English sources

The title is underlined and divided across three lines.

It could have been written in boldface capital letters, underlined and highlighted with a fluorescent marker.

I suspect that's what the heavily underlined and annotated Bibles were all about.

Usually appears underlined and in a different color.

The target items consisted of 12 single words (six in bold typeface/underlined and six not in bold typeface/not underlined) and 12 formulaic sequences (six in bold typeface/underlined and six not in bold typeface/not underlined).

For each target, the maximum AUC reached is underlined and in bold font.

The mutagenic oligonucleotides adopted as primers are ACCTTCTACGAGGGAGGATACGCCGCTATTAG (Fw) and CTAATAGCGGCGTATCCTCCCTCGTAGAAGGT (Rev), with the mutated nucleotides underlined and bold.

Individual cellulase cDNA's were also cloned into pPIC9: cbhII was amplified with primers cbhF and cbhRS (5´-GGCGGCCGCTTACAGGAACGATGGGTTTGCGT, NotI site is underlined) and eglII with primers egl2F (5´-GGGATCCAAAATGAACAAGTCCGTGGCTCCATTG, BamHI site is underlined) and egl2R.

Two Hd1 exons are marked with boxes, and the intron junctions GT… AG are underlined and marked red.

My copy is heavily dog-eared, underlined and dusty.

Bold print and underlined, and it still doesn't get done as often as it should.