Sentence examples for underline the same from inspiring English sources

Both representations underline the same tendencies.

Finally, the content of the variables which belonged into the same factor had to underline the same construct, so that it would make sense their all together consisting a factor under a new name.

However, even if synteny-based projections can be useful to identify new candidate genes that explain trait variation across taxa, when orthologous QTLs underline the same trait, the involvement of each orthologous gene to the phenotype may vary across taxa.

The rot gene was PCR-amplified from 8325-4 chromosomal DNA using the primers KpnI-rotF (5'-TTACCATGGTACC ATTGGGAGATGTTTAGCATG) and SacI-rotR (5'-ACATCAGAGCTC CCAACGTAATCATGCTCCAT) which, except for the added restriction sites (underlined), are the same primers that J. Oscarsson used to clone rot in pWA163 [11].

Moreover, as underlined by the same authors, no control study, with vitamin C alone, were performed.

57 The need for a more complete assessment to detect geriatric problems in older cancer patients admitted to geriatric wards was underlined by the same authors.

There is a growing body of evidence that these two laterality disorders, SIT and HS, are actually part of a phenotypic continuum, underlined by the same genetic defects.

The Convention on Human Rights and Biomedicine leaves in fact wide freedom to member States in order to decide about allowing hESC utilization underlining, at the same time, the importance and necessity of guaranteeing an adequate protection of embryos' health.

And when we showed Walt our notes and played the song sketches, he pulled out his book, and he'd underlined the very same chapters".

The T7 template sequence (5' TAATACGACTCACTATAGGCGAAAGCAGGTACTGATTGCGACAATGC 3') contains the T7 promoter region which is the first 18 nucleotides and the remaining 29 nucleotides (see the sequence underlined) are the same sequence as that of the flu template.

where (underline {ell }_{i} = U underline {h}_{i}) has the same probability density function as (underline {h}_{i}), i=2,…,K.