Sentence examples for underline letters from inspiring English sources

We can see the total running-time from Table 4. Smallest running-time for each function is highlighted in bold underline letters.

No matter whether it was reached or not, the number of epochs that were needed to reach the threshold was rounded off and recorded in Table 3. Best performance (i.e., lowest number) for each function is highlighted in bold underline letters.

Enter the different applications by simply selecting the underline letter of their descriptions on the home screen (see Tips).

Numbering is relative to the Ddc transcription start site [75], and underlined letters represent Ddc exons.

The PCR primers used to amplify the fragment (688 bp) of DmWhite were as follows: forward primer DmWhiteF (5'-GG CTCGAG ATG GGC TAC CGG CGC CCA GGA AAC ATT-3', spanning nucleotides 322 342; underlined letters indicate a XhoI site) and reverse primer DmWhiteR (5'-GG GCGGCCGC TAG GAA AAG AAG TCG ACG GCT TCG C-3', spanning nucleotides 1009 985; underlined letters indicate a NtoI site).

b The underlined letters indicate the restriction sites.

We were able to extend the VDAC and Sam50/Tob55 sequences (underlined letters in fig. 1) but not the Tom40 sequence.

*Allelic variants denoted in bold face underlined letters represent the best favourable alleles as proposed in the references.

The sequences of the forward strands were as follows (underlined letters denote phosphorothioate-bonded bases; mutated bases are printed in bold and italics).

The primer used were 5'-CATCATaccggt ATGGACTACAAAGACGATGACGATAAA ATGAATTTGCAACTGGTT TCCTGGATTGGA-3' (small letters represent a restriction site for AgeI and underlined letters represent FLAG sequence) and ATGATG ACTAGTTCATTTTCCCTCATACTTCGGATTGACCAC (bold letters represent a restriction site for SpeI).

The sequences of the single-stranded ODNs were (underlined letters denote phosphorothioate-bonded bases): STAT-1 consensus decoy ODN: 5'- catgttatgcatattcctgta agtg-3'; STAT mutant control ODN: 5'- catgttatgcagaccgtagta agtg-3'.