Your English writing platform
Discover LudwigSuggestions(5)
Exact(11)
Under standard procedures, the Economic Planning Agency has two more opportunities to change its figures, in December and again next year.
The Cole entered Aden operating under standard procedures based on the level of threat in that port, and would have done the same in any port in the world where the threat was deemed comparable.
Furthermore, all the assays were performed under standard procedures set up for optimizing enzyme in vitro activities.
Extractions were performed under standard procedures.
The colon dataset was applied under standard procedures of STEM.
Technical performance was excellent for CMA, and similar to QF-PCR or karyotype under standard procedures.
Similar(46)
Under standard procedure in cases of capital punishment, his recommendation went to the office of Egypt's Grand Mufti, the nation's top Muslim theological authority, for endorsement.
If a war were to begin, there would be little or no opportunity at the onset to advertise on most broadcast and cable networks, which under standard procedure would limit or eliminate commercials if they are presenting war coverage.
But, given the targets in question huge banks, well-insulated executives, intricately structured financial products, tens of millions of knotty documents—it's unlikely that a federal prosecutor's office, staffed by generalists and operating under standard procedure, which is to wait for cases to come in, could have made serious headway.
But, given the targets in question — huge banks, well-insulated executives, intricately structured financial products, tens of millions of knotty documents — it's unlikely that a federal prosecutor's office, staffed by generalists and operating under standard procedure, which is to wait for cases to come in, could have made serious headway.
The product was amplified by the PCR with following universal primers: (27 F) AGAGTTTGATCGTGGCTCAG and (1492l R) GGTTACCTTGTTACGACT under standard procedure.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com