Sentence examples for under sequencing from inspiring English sources

Two pilot-scale bio-filters, loaded with different types and sizes of support media, were operated under sequencing batch (SBR) mode with recirculation.

Today, with the many prokaryotic genomes already sequenced or under sequencing, many cell wall-bound or secreted proteins can be identified from the deduced protein sequences.

For AsPAL1 the same protocol was used as described under sequencing and the primers 5'CAGTAATACGACTCACTATAGGGAGAAGGCTCTCCGAGCTCCAGT3', 5'CCACGAACACCTTGTCACAC3' for the forward reaction and 5'GAGAAGGACCCGCTCAACTG3', 5'CAGTAATACGACTCACTATAGGGAGAAGGCTAGAAGGCTCCACGAACACCTT3' for the reverse reaction.

Hence, it is possible that some of the p63 isoform expression data derived from the RNA-Seq experiments as described here, could in part be tinged with effects from over or under sequencing and thus might not be completely accurate in the biological context.

Under-sequencing is intuitively an obvious problem which can be visualized using our methods (e.g. 3Mbp 5L-0P and 0L-5P in Figures 1 & 2).

Assuming strains are relatively similar (sequence divergence based on mitochondrial cytochrome oxidase I is ~2% [ 24]), the degree of overlap in transcriptome sequence datasets between strains was relatively small (~15%), potentially indicating a high degree of under-sequencing in both cases.

There is no need to repeat the process for more than three total rounds or over-under sequences.

A probabilistic approach to decision-optimal design and damage control is developed for structural systems that can gradually accumulate damage by nonlinear behavior under sequences of dynamic loads, whose occurrence can be idealized by renewal stochastic processes.

These basic topological features were found to be robust to alignment and under sequence truncation to the primer region, data not shown.

Approaches comparing vertebrate genome sequences, such as those employing 29 mammals, have revealed regulatory regions under sequence constraint (Lindblad-Toh et al., 2011).

The raw transcriptome sequence files for watered, S1, and S3 have been uploaded, together with gene expression result files, to NCBI's Gene Expression Omnibus under sequence number GSE48507.