Your English writing platform
Discover LudwigExact(1)
A probabilistic approach to decision-optimal design and damage control is developed for structural systems that can gradually accumulate damage by nonlinear behavior under sequences of dynamic loads, whose occurrence can be idealized by renewal stochastic processes.
Similar(59)
There is no need to repeat the process for more than three total rounds or over-under sequences.
Under-sequencing is intuitively an obvious problem which can be visualized using our methods (e.g. 3Mbp 5L-0P and 0L-5P in Figures 1 & 2).
Two pilot-scale bio-filters, loaded with different types and sizes of support media, were operated under sequencing batch (SBR) mode with recirculation.
These basic topological features were found to be robust to alignment and under sequence truncation to the primer region, data not shown.
Today, with the many prokaryotic genomes already sequenced or under sequencing, many cell wall-bound or secreted proteins can be identified from the deduced protein sequences.
Approaches comparing vertebrate genome sequences, such as those employing 29 mammals, have revealed regulatory regions under sequence constraint (Lindblad-Toh et al., 2011).
The raw transcriptome sequence files for watered, S1, and S3 have been uploaded, together with gene expression result files, to NCBI's Gene Expression Omnibus under sequence number GSE48507.
For AsPAL1 the same protocol was used as described under sequencing and the primers 5'CAGTAATACGACTCACTATAGGGAGAAGGCTCTCCGAGCTCCAGT3', 5'CCACGAACACCTTGTCACAC3' for the forward reaction and 5'GAGAAGGACCCGCTCAACTG3', 5'CAGTAATACGACTCACTATAGGGAGAAGGCTAGAAGGCTCCACGAACACCTT3' for the reverse reaction.
The less-amplified regions are not efficiently sampled by the shotgun sequencing procedure, and extremely high sequence coverage is required to recover the under-represented sequences.
These results suggest that the under-represented sequences probably arise from the parental sequence by somatic mutation.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com