Sentence examples for under sequence from inspiring English sources
These basic topological features were found to be robust to alignment and under sequence truncation to the primer region, data not shown.
Approaches comparing vertebrate genome sequences, such as those employing 29 mammals, have revealed regulatory regions under sequence constraint (Lindblad-Toh et al., 2011).
The raw transcriptome sequence files for watered, S1, and S3 have been uploaded, together with gene expression result files, to NCBI's Gene Expression Omnibus under sequence number GSE48507.
Then, the library GMC of the genome G by the library lib (GMCGlib) is defined by: GMC G lib = ∑ i = 1 S b covered SG × 100 To measure the proportion of scaffolds with sequence similarities to these genomes for calculating the GMC, we recorded all regions in a pool library for which BLASTn produced HSPs with the reference genome under sequence identity >70%, alignment length >150 bp, and E < 1e-9.
Under-sequencing is intuitively an obvious problem which can be visualized using our methods (e.g. 3Mbp 5L-0P and 0L-5P in Figures 1 & 2).
There is no need to repeat the process for more than three total rounds or over-under sequences.
Two pilot-scale bio-filters, loaded with different types and sizes of support media, were operated under sequencing batch (SBR) mode with recirculation.
A probabilistic approach to decision-optimal design and damage control is developed for structural systems that can gradually accumulate damage by nonlinear behavior under sequences of dynamic loads, whose occurrence can be idealized by renewal stochastic processes.
Today, with the many prokaryotic genomes already sequenced or under sequencing, many cell wall-bound or secreted proteins can be identified from the deduced protein sequences.
For AsPAL1 the same protocol was used as described under sequencing and the primers 5'CAGTAATACGACTCACTATAGGGAGAAGGCTCTCCGAGCTCCAGT3', 5'CCACGAACACCTTGTCACAC3' for the forward reaction and 5'GAGAAGGACCCGCTCAACTG3', 5'CAGTAATACGACTCACTATAGGGAGAAGGCTAGAAGGCTCCACGAACACCTT3' for the reverse reaction.
Penn State, in comparison, suffered the most of anyone under this sequence of events.
