Sentence examples for uk targeted from inspiring English sources

Video footage shows Reyaad Khan, from Cardiff, killed in UK targeted drone strike.

A recent campaign for the Ford Galaxy in the UK targeted dads out with their children on a holiday break.

More recently research carried out by the Tow Center unearthed Russian-bought UK targeted immigration ads relevant to the Brexit referendum among a cache Facebook had provided to Congress — which the company had not disclosed to the UK committee.

Until recently, Bashir's case was an extreme example, but last week the Home Office quietly announced a gruelling new policy that would see all refugees settled in the UK targeted with a "safe country review" after five years to decide whether they should be allowed to stay here, leaving all refugees with the permanent psychological burden of never being able to settle.

Until recently, Bashir's case was an extreme example, but last week the Home Office quietly announced a gruelling new policy that would see all refugees settled in the UK targeted with a "safe country review" after five years to decide whether they should be allowed to stay here, leaving all refugees with the permanent psychological burden of never being able to settle.

siRNAs (Dharmacon, Epson, UK) targeted to human Themis2 (siRNA A: caauguguacagcaagauu, siRNA B: gaucccgucuacgcuggauu), STAT3 (ccaacaaucccaagaaugu) or a pool of non-targeting siRNAs (cat. # D-001206-13) were mixed (20 min, RT) with Dharmafect 1 (Dharmacon, Thermo Scientific, Epsom, UK) in serum-free OptiMem (Invitrogen).

Primary HMECs were transfected with Accell small interfering RNA (siRNA) oligos (GE Healthcare Dharmacon, Little Chalfont, UK) targeting AMPK α2 and PEA15 as per the manufacturer's protocol; nontargeting pool siRNA (GE Healthcare Dharmacon) was used as control siRNA.

To knockdown Bim, we used a mixture of four different siRNA duplexes (Catalog no. M-004383-02, Thermo Surreyific Dharmacon, SUKrey, UK) targeting all three major transcript variants of Bim (Bim-EL, Bim-L and Bim-S).

First, Mrs May failed to reach UK targets on immigration during her time as home secretary.

False allegations that Saddam could attack UK targets within "45 minutes" were not withdrawn until 28 September 2004.

Wind power, especially offshore, is considered one of the most promising sources of 'clean' energy towards meeting the EU and UK targets for 2020 and 2050.