20 ug of RNase A was added to the eluted sample to remove RNA contaminants and this was followed by three more rounds of phenol/chloroform extraction and ethanol precipitation.
0.75 ug each of Ad-helper plasmid, AAV helper plasmid (either Rep2Cap2, Rep5Cap2, or the Rep mutant described), and the GFP plasmid containing the ITR (mutant or wt ITR as specified in text) were triple-transfected with PEI (25,000 linear molecular weight) as described [25].
BMI-body mass index, FEV1%-percent of predicted of forced expiratory volume in 1 second The rate of FEV1 decline was measured after administration of a 400 ug of salbutamol, a short acting bronchodilator.
Approximately, 2 ug of poly(A) RNA was isolated from equal mixtures of the three total RNAs using an Oligotex mRNA Midi Kit (Qiagen, Shanghai China).
Five groups of 8 participants received virosomal formulations containing 10 ug or 50 ug of AMA49-C1, an AMAMA-1erived synthetic phosphatidylethanolamine (PE -peptide conjugate, or 10 ug or 50 ug of UK-39, a CSPE -peptideyntheticonjugateide corjugate, or 50 ug of both antigens each.
Three seconds after contact, as little as 10 ug of PlyG mediated a 5,000-fold 5,000-foldn viable counts of a ~107 bacillus culture [ 8].
The procedure was done as described by the manufacturer using 1 ug of total RNA, a reverse gene specific primer (5': GACGCTTGGCCTCTCTGAT) in the primary PCR, and a reverse nested gene specific primer (5: CGGGGAATCTGGGGAAGTTGTCC).
After elution, the pooled sample was dialyzed in 1× ProBond Native Buffer and simultaneously incubated with 300 ug of TEV Protease (a gift from Dr. Leahy, Johns Hopkins University).
Because the maximum capacity of a glass syringe filter for soluble plasmid DNA in the presence of chaotropic agents is about 150 ug, 4 glass syringe filters can purify up to 600 ug of plasmid from a cleared cell lysate.
