Sentence examples for type reporter from inspiring English sources

Exact(9)

Specifically, GFP fluorescence of mutant reporter strains ΔgadX/puspE-gfp and ΔuspE/pgadX-gfp were compared to fluorescence of their corresponding wild type reporter strains, BW25113/puspE-gfp and BW25113/pgadX-gfp, respectively.

Mutation or deletion of Nkx2-5-binding elements was carried out by amplifying the promoter from the wild type reporter construct using oligonucleotides harboring modified DNA sequences (containing PstI sites) and primers on both sides of the promoter sequence and surrounding the cloning site of pGL3 vector: pGL3-1 (ctagcaaaataggctgtcccag) or pGL3-2 (ccaagcttacttagatcgcaga).

Wild and mutant type reporter vectors with miR-18b complementary sites were confirmed by sequencing.

The values were scaled in each replicate to 1.0 for Scp-2 cells and the wild type reporter.

The resulting DNA fragment was inserted into the 5' region of pGL3 basic promoter (Promega) to produce the wild type reporter construct.

The activity of the wild type reporter showed a concentration dependent down-regulation by the wild type siRNA while the mutant reporter showed little variation of the low level activity.

Show more...

Similar(51)

Luminescence of the wild-type reporter but not the sdiA mutant at the junction indicates SdiA activity [2].

We constructed three mutant reporter alleles, designated the PRNP-P102L, PRNP-P105L, and PRNP-D178N alleles, and their corresponding wild-type reporter alleles (Figure 1A).

In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes.

Overexpression of ESRP1 still promoted exon switching of the UGCAUG-mutated reporter, but the ratio of exon 8 selection was slightly reduced (Figure 6A, lane 8) in comparison with the wild-type reporter (Figure 6A, lane 3).

The reporter alleles, synthetic siRNA duplexes against the mutant alleles (supplementary Table s1 and supplementary Figure s1), and the beta-galactosidase gene (control), were cotransfected into HeLa cells; thus, the transfected cells were artificially heterozygous with the mutant and wild-type reporter alleles.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: