Sentence examples similar to two more generated from inspiring English sources

Finally, we abstract the insights of this paper to generate two more general insights about law.

But, two more are generated from the combination of image regions belonging to both objects.

The new research is already paying dividends, he says: Astronomers have found at least two more sites generating signals from C6H-.

"Lambotte's Citysearch ad received a total of 7 clicks (plus two more that he generated) between December 11 and 25, 2007.

By 2020, we could attract 98 million more visitors, generate $390 billion in exports (spending) and create 1.3 million jobs.

Smith will need a considerable set of concessions from owners to sway his constituents, who are concerned about the injury risks two more games may generate.

These four labelings generated two more in n=5, while 4.2 and 4.6 only generated one each.

Apple, the world's most valuable company — its market cap passed six hundred billion dollars briefly last month, and is currently hovering at a little more than five hundred billion — generated more than twenty-five binlion dollars in profits last year.

The tragedy, which killed three students and injured two more, has once again generated conversations about bullying.

Specifically we generated two more probes, corresponding to the genes Trehalase1 and B9, to expand our walk on both directions.

To increase our signal, we inserted two more copies in pLCM2, generating a 3xFLAG (GATTACAAGGATGACGACGATAAGGACTATAAGGACGATGACGACAAAGATTATAAAGACGACGATGACAAG) Rat1∆NLS plasmid (pLCM6).