Sentence examples for tree portion from inspiring English sources

Exact(1)

After tasting the first dozen bourbons in the Single Oak Project, I was amazed by how much difference a single variable, such as wood-grain size or tree portion, makes.

Similar(59)

2. Did you "Christmas tree" any portion of this test?

In order to determine the genotype of each tree, a portion of the Lim1 gene was amplified from trees using forward (ACCAGTATGCCTTCATTGTGTTC) and reverse primers (AAAGACCAATGTCCCTAATAGTCATG).

Results from the study show the tree dominated portions of the stream reach consumed approximately 2.4 ML ha−1 yr−1 more groundwater than a common forage grass.

In Valiant's original description there was some intersection between the inputs of recursive calls in different branches of the recurrence tree, where portions of the data were re-computed more than once.

If a significant amount of pruning needs to be done for a tree, do portions of it over several seasons.

The APP for the selected nodes were obtained by multiplying the mean ancestral character state probability of a given node across all trees by the portion of the trees in which the node involved was found [ 64, 65].

Ancestral posterior probabilities were obtained by multiplying the mean ancestral character state probability of the selected node across all trees by the portion of the trees that recovered the node involved.

Thick canopies of trees envelop portions of the road, and it's not uncommon for the piercing sun to cast spooky shadows onto the landscape.

"That will protect the tree or that portion of the tree — the bottom and the trunk — from freezing".

Rescuers spent hours trying to reach the mother and infant who died in Wilmington after they were trapped by a tree and a portion of the roof that had collapsed on them, said J.S. Mason, a deputy fire chief.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: