Sentence examples for translational site from inspiring English sources

Exact(1)

Fragments from nucleotides −1 (upstream of the ATG translational site) to −2.2 kb, −645 bp, −290 bp and −150 bp (termed as p2.2, p645, p290 and p150) were PCR amplified respectively and subcloned into the pGL3-basic reporter vector.

Similar(59)

KMnO4 hypersensitive TAs were also observed in other sequences that position nucleosomes at single translational sites including the synthetic fragment 601 and the 5S rDNA sequence from sea urchin [36], [37].

However, for Trap the translational start site overlaps with a splice acceptor site, therefore homology arm E extends +12 bp past the translational start site in the same reading frame as ECFP.

All identified LexA-binding sites were associated with the predicted protein-coding gene in the metagenome sequence whose translational start site was closest to the LexA-binding site.

Consistent with this finding, we have found that the natural construct, which includes the distal translational start site in tandem with the proximal translational start site, promotes only minimally activity Figure 5.

The putative translational start site is located 16308 bp upstream of the annotated transcriptional start site of TET3.

We also confirmed the translational start site of 1, 720 proteins and discovered a number of previously unknown start sites.

Morpholino oligonucleotides (MO) complementary to the translational start site of the zebrafish Parp3 (MO1) and to the sequence immediately upstream of the translational start site of Parp3 (MO2) had the following sequences: MO1: [5'ATGCTGCCCTTCTCTTGGGTGCCAT], MO2: [5'CTTTGTCCTCTGATACTGGCGGT-AC] (Fig. S1B).

Promoter-deletion analysis revealed that the regulatory elements conferring light-responsivity reside within −165 bp of the translational start site.

a Distribution of W-box and W-box like elements in the OsWRKY4 promoter, 1.5 Kb upstream from the translational start site.

Antisense oligonucleotide complementary to the mRNA translational start site of the rat dopamine transporter was delivered by constant (7 days) intranigral infusion with an osmotic minipump.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: