Sentence examples for translation context from inspiring English sources

To overcome this, we transfer the well-known multi-amalgamation concept from algebraic graph transformation to TGGs, allowing us to mark certain parts of rules as repeated depending on the translation context.

To rule out that the observed localization pattern could result from the constitutive overexpression of PpHsp16.4 in heterologous systems, we examined in detail the targeting of fusion proteins expressed in their natural transcription and translation context in P. patens.

An ATG upstream in frame can be explained by the ribosome scanning model, which scans from region 5' to region 3' until it finds the first ATG which contains a translation context.

The ATG start codon of all of the ORFs is in a favorable context (Table  2), which at least partially agrees with the optimal translation context of plant mRNAs [ 30].

Thus TISU represents an optimal form of translation initiation context.

We demonstrated that TISU, which has an invariable ATG, composes a strong translation initiation context.

Thus this element represents a translation initiation context characteristic of genes with a very short 5'UTR.

These facts, as well as an ORF1 start codon in an unfavourable translation initiation context and poor codon usage for ORF2, led to the hypothesis that pgc functions as a transcription-repressing non-coding RNA [1]; [3].

In transcript B, however, there is no ORF with the optimal translation initiation context.

synJ carries a near consensus sequence for translation initiation context (TIC) and an upstream region.

The 28 nt long synJ (ACACGCTGGAATTCTAGTATACT AAACCaug G) carries part of the near perfect translation initiation context (shown in bold) and an upstream region of 23 nt.