Sentence examples for transient human from inspiring English sources

Exact(6)

Rock music is made by transient human beings, some of whom have vanished altogether.

So enjoy those bizarrely tardy and transient human rights for a day or two, because the medieval re-enactment society is coming to smack you in the face with a crumbling parchment.

But it seems to emphasize not only how transient human life is, but, as we see with Tut and his tomb, also how long its traces might be felt.

By building more transient, human technology that seeks to mimic the privacy of memories – which remain, for now at least, locked safely in our skulls.

The finite artistic plenums she depicts and materializes are representative of a holistic and infinite totality of "essences" -- which really are no more than transient human experiences artificially reduced to concepts for as long as they are valuable for practical use.

Low titer, transient human anti-chimeric antibody positivity was observed in two patients.

Similar(54)

Lemaitre, G. et al. CD98, a novel marker of transient amplifying human keratinocytes.

The risk posed by large numbers of transient casual human contacts has not been adequately defined.

We demonstrate that sudden but small cytoplasmic movements can be detected in near synchrony with each PLCζ-induced Ca2+ transient in human oocytes that had failed to fertilize after ICSI.

For transient transfection, human TRPC5 cDNAs was cloned into pEGFPN1 and point mutations were introduced using QuikChange® site-directed mutagenesis (Stratagene) and appropriate primer sets (forward (5′ 3′): GCTTTACTTCTATTATCAAACCAGAGCTATCGATG; reverse (5′ 3′): CATCGATAGCTCTGGTTTGATAATAGAAGTAAAGC).

In summary, although the progesterone-induced [Ca2+]i signal was detectable first in the flagellum, where CatSper is present, pretreatment with 2 5 μM 2-APB 'amplified' the progesterone-induced [Ca2+]i transient of human sperm at the PHN and midpiece by enhancing activation of a Ca2+-permeable channel that is not CatSper.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: