Sentence examples for transformation was generated from inspiring English sources

A sequential γ → ε → α ' martensite transformation was generated during tensile and brought the transformation induced plasticity effect.

The transfer DNA (T-DNA) construct for A. thaliana transformation was generated in the vector pGPTV_bar (25).

To create an accurate registration, care was taken to spread the landmarks throughout the vertebrae in 3D, and a rigid body transformation was generated.

The non-linear transformation was generated by the local weighted mean (lwm) method of cp2tform (See Matlab help and references thereafter).

The gauge transformation is generated by the scalar field λ, which can be any function of space and time.

The complementary A polynomial required for the SLR transformation is generated with the Hilbert transformation, yielding the minimum-phase response.

In addition, the phase transformation is generated symmetrically along the axis of nanowire, as can be seen by the rectangles in Figure 4b.

The transformation amplicon was generated by PCR using (TTGATCCTGCTTTTAACAATTTCGAATCGTTTGCGTAATTGAATTCGAGCTCGTTTA AAC) and (CCTCCTCTGGAGGCTTAATCTTAAAAAATTTCTTTAATCCGCACTGACGAGCGTAATCTG) using pFA6a-HIS3MX6-PGAL1-HA3 as a template, resulting in a transformation cassette directed in-frame to the N-terminus of Sec9p.

This study demonstrated a stable transformation system was generated for Phal.

The selected segment was scanned, and an ensemble average of 256-point fast Fourier transformation (FFT) spectra was generated using a Blackmann-Harris window with 50% overlap (i.e., 12.3 ms).

For co-expression of eqFP611 and smGFP4 in N. benthamiana, a binary vector suitable for plant transformation by agrobacteria was generated.