Once the codes were agreed to, the transcripts were loaded into the software, and the coding of each transcript was done to identify recurring themes.
Once transcripts were loaded into the software, a line-by-line coding of each transcript was done using both inductive and deductive approaches to identify recurring themes.
Determining the stability of the mutant transcript versus the wild-type transcript was done with RT-PCR using forward primer 5′-GAGGCGATTCCAGTAACAGC-3′ and reverse primer 5′-GAAAGCATCAAAGGTCTCAGGTG-3′; the product of this reaction was digested with MseI.
Examination of the fusion transcript was done with a forward primer in the first part of the transcript (F 5'CandCTGTTCTGaCGGTTCCA3') and a reverse primer in the other part (R 5'CAAAGTAGAATATAGTTGTCCAAAACACAA3'CAAAGTAGAATATAGTTGTCCAAAACACAA3
Cell line K562 was used as a positive control and reference, its EVI1 expression level was set to 1. QRT-PCR for the BCR/ABL1 fusion transcript was done according to the Europe Against Cancer program (EAC) protocol [ 11].
The quantitative real-time PCR of Orai1, STIM1, and HPRT mRNA transcript was done using MESA GREEN qPCR MasterMix Plus for SYBR Assay (Eurogentec, Angers, France) on the Biorad CFX96 Real-Time PCR Detection System.
Expression profiling of CXCR4 transcript was done by semiquantitative RT-PCR in eight CC cell lines (HeLa, SiHa, ME-180, C-33A, CaSki, C-4I, MS751, and SW756), 63 (60 squamous cell carcinomas and 3 adenosquamous) primary tumor biopsies, and 30 normal cervical tissue samples.
Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL) of children with autism (n = 82) and controls (n = 64).
When his transcripts are done, he sends them to a company in California for more proofreading, correcting and pagination.
Semi-quantitative PCR of cDNA samples of PTK6 transcripts was done using two sets of human PTK6 primers.
