Sentence examples for track assay from inspiring English sources

The results of the scratch assays from DKO and control EC were confirmed using a single cell migration track assay in which migrating cells engulf fluorescent beads leaving a non-fluorescent track (Figure S4C).

They involve proprietary secrets, and their manufacturers do not always observe transparency (36) or track assay performance closely.

We would also like you to tone down the comment about the use of the M track assay to establish the close proximity between Rec8, Red1 and Hop1.

miR-510 expression was able to increase the ability of MCF10A cells and MCF7 cells to migrate in the absence of a stimuli as assessed by the Pacman haptokinetic migration track assay (Additional file 1, Figure S1).

PCR primers were as follows: AMF forward, gcttgaccctcaacaccaac; reverse, gaagtgctggtccatccagt; AMFR forward, caggaggaagtgagccagtc; reverse, agcttgctgcctaaccactc. Phagokinetic track assay was performed according to the method reported by Albrecht-Buehler (1977).

Finally, the real-time three-dimensional matrix deformations of agarose hydrogel under the influence of chondrocytes were measured using a multiple-particle tracking assay.

We examined the thermokinetic behaviors of infective third-stage larvae (L3) of the rodent parasitic nematode Strongyloides ratti on temperature gradients using an in vitro agarose tracking assay method.

We did not observe mixed infections from the DNA sequences, which has since been confirmed using a heteroduplex tracking assay [28]; Juliano and Meshnick, unpublished).

To specifically address this issue, we employed a time-lapse live cell imaging and tracking assay using Hela cells expressing EGFP-H2B protein.

The real-time 3D tracking assay was used to determine how fly movement and trajectories might be affected by hydrogen peroxide treatment.

Here the effects of hydrogen peroxide on Drosophila movement were analyzed using a recently developed three-dimensional real-time multiple fly tracking assay.