Sentence examples similar to toward which target from inspiring English sources

Toward the end of Part 1 — which Target Margin performed as two separate plays in 2004 and 2005— Gretchen, vividly played by Eunice Wong, appears at her famous spinning wheel singing her grief and longing.

Another similar example is Aurora A transgenic mice, when Aurora A protein is overexpressed, it is ubiquitinated by the cells, which targets it toward the ubiquitin-linked protein degradation system.

Niecza, which targets the Common Language Runtime.

TAS2 produces TATTCGAGTATATGCAAAAGA, which targets just TAS1A.

If you're looking for a reason to be angry this Monday morning, I'll do you one better with a reason for anger and a target toward which you can direct that rage.

21 To achieve this, we set 50% reduction as the target, toward which an intervention strategy was developed and implemented.

In addition to the antiplatelet drugs reported above, there is a continuous effort to identify newer targets toward which to direct pharmacological strategies.

The patterns generated by microsatellite selection here rely on the fact that there is a target allele size toward which the allele frequency distribution progresses.

The other, which contacts tropomyosin rather than actin, is positioned M-ward of the target zone, i.e. the position toward which thin filaments slide during shortening.

A positive frequency is defined as one for which the target is moving toward the system.

And toward which specific ends?