Sentence examples for top strands from inspiring English sources

Spicer wears his hair clipped short at the temples and parted on the left, the longer top strands gelled down over his scalp against the threat of a strong wind.

Only one strand was sequenced for amplicons Me3, CG1, (bottom strands), and Me4, CG2 (top strands).

The top strands of each duplex were 5′-labeled with fluorescein or unlabeled.

(I) Equilibria of 19 nt duplex mimics of a portion of the 39 nt hairpin with homodimers of the top strands of their duplexes.

Here, we replaced respectively the top or bottom strands of FM1, and bottom or top strands of M1F with non-5′ phosphorylated versions of the 0 MM control oligonucleotide.

Tie the top strands together.

For the crystallization of the Mot1NTD TBP DNA NC2 complex, 24 double-stranded DNA (5′-AGTAGGGCTATAAAAGGGGGTGGC-3′ top strand) was used.

Subsequent exposure of the respective bottom or top strand as a single-stranded repair template would render TpC susceptible to deamination by APOBEC to TpU.

For the CX-MS analysis of the Mot1 TBP DNA NC2 complex, 42 double-stranded DNA was used (5′ CAGTACGGCCGGGCGCCCGGCATGGCGGCCTATAAAAGGGTC 3′ top strand).

The top strand-specific BGS primers for bisulphite-converted single-stranded DNA of the DLEC1 promoter are listed in Table 1.

Add 10ul top strand oligo 10-20uMM) and 10ul bottom strand oligo 10-20uMM) into 80ul annealing buffer (10mM Tris-HCl, pH 7.5, 0.1M NaCl, 1mM EDTA).