Sentence examples for toolkit version from inspiring English sources

All the acoustic features have been extracted with our openSMILE toolkit version 2.1 [2.1.

The implementation of the HTS toolkit (version 2.1) that we used in this work is publicly available on the HTS website [11].

We use the open source Terrier toolkit version 4.1 [20] to index the collection with the recommended settings of the toolkit.

We haven't reviewed the Google Reader for iPhone before (not to be confused with the Web Toolkit Version) so I gave it a spin.

The Geant4 toolkit (version 10.1.p02) was used to simulate 6-MV photon beam of a Varian2100C linear accelerator that is being used for stereotactic radiosurgery (SRS) treatment with small radiation fields.

Local realignment around indels (RealignerTargetCreator, IndelRealigner) and base score recalibration (BaseRecalibrator) were applied by GATK (The Genome Analysis ToolKit, version 3.1-1) (McKetnalet al., 2010) to ensure accuracy in identifying indels and single nucleotide variants (SNVs).

The obtained raw reads were cleaned using the FASTX-Toolkit (version: 0.0.13) [ 32].

Quality trimming and adaptor removal for both DNA and RNAseq reads were done with FASTX-Toolkit (Version 0.6.1).

The adapter sequences "(N10 TCGTATGCCGTCTTCTGCTTG" were cut from the raw reads using FASTX-Toolkit (Version 0.0.13) (http://hannonlab.cshl.edu/fastx_toolkit/).edu/fastx_toolkit/

Before assembling the paired-end Illumina/Solexa reads, the script fastq_quality_filter included in the FASTAX-Toolkit version 0.0.13 (http://hannonlab.cshl.edu/fastx_toolkit/download.html) was facilitated to remove reads of low quality (the minimum quality score to keep is 20).

The primary processing and filtering of the sequence data was performed using the FASTX-Toolkit version 0.0.13 [ 52] using the option ' Q33" in FASTX-Toolkit to convert the Illumina quality to Sanger quality.