Sentence examples for toolkit for further from inspiring English sources

Exact(1)

In addition, the adaptive resonance theory, particularly ART2, neural network has been applied as a toolkit for further customer and marketing analysis.

Similar(58)

This, in turn, helped shape the definition and development of the toolkit concept designs, which were then shown and trialled for further feedback during consecutive stages.

Moreover, the methylation information and novel findings can be viewed by the visualization modules based on Apache Batik Scalable Vector Graphics (SVG) toolkit, and can be downloaded before exiting the browser for further reuse.

Next, the Illumina adapter sequences (5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG) and (5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT) were removed using the fastx_clipper, which is part of the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were <32 bp in length were discarded for further analyses.

After a stringent quality filtration of the raw read data using the FASTX-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/index.html), a total of 31,591,337,787 nt filtered data were selected for further analysis (Additional file 3).

We accepted for further analyses samples that amplified at least 9/14 loci, and used the Excel Microsatellite Toolkit (Park [ 30]) to test for the presence of matching profiles.

The small size, minimal targeting constraints, and modular regulation of Cas13d effectors further expands the CRISPR toolkit for RNA manipulation and detection.

To further explore these complex data, an integrated toolkit for various molecular representation is urgently needed which could be easily integrated with data mining algorithms to start a full data analysis pipeline.

Further, they've launched Form X, an experimental toolkit for makers and engineers.

Moreover, recent studies of Cas proteins have further improved the flexibility and precision of the CRISPR-Cas toolkit for genome editing.

Further evaluation of these standards is required for potential incorporation into a 'quality metrics' toolkit for assessing their suitability for cross-platform comparisons.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: