Sentence examples for to the inserted from inspiring English sources

These primers bound the insertion junction, with the two 3′-most bases binding to the inserted sequence.

Clones were confirmed by PCR with primer pairs targeting sequences in the inserted genes (DsRed2, A33R, B5R), and with HSV-2 UL41-specific primers (UL_41_F; 5'GGGGGTCTTCTTCGTAGTCG and UL_41_R; 5'ACATCAGCACCGGCTACATT) hybridizing close to the site of insertion whereby generating fragments of different size according to the inserted gene.

That results in the silencing of a gene that corresponds to the inserted RNA.

The first have already failed, as so-called superweeds have developed resistance to Roundup, and the second are showing signs of failing, as insects are able to develop resistance to the inserted Bt toxin — originally a bacterial toxin — faster than new crop variations can be generated.

These results are attributed to the inserted AZO front channel layer serving as the mobility booster.

The mechanism by which the properties of the solar cells are related to the inserted layers is presented.

Press any key to boot from the inserted disc.

Ok, is it difficult to remember to insert the gel?

The struts are fitted to the bushings inserted into the base-plate of the optical bench.

Go to the Insert menu, and then Break, and select Section Break (Next Page).

Another option is to go to the Insert menu, choose Symbol and select the appropriate character.