Sentence examples for tipping procedure from inspiring English sources

An employee at a hotel in Manhattan advised, "As you check in you can ask, 'Oh, by the way, what is the tipping procedure for the room attendants?"' Speaking anonymously, since he did not have permission from his employer, he answered another burning question: Is it tacky to give a bellhop a $20 bill and ask for change?

Getting food delivered by services like DoorDash or Seamless without the awkward eye-to-eye tipping procedure with the pizza guy is very easy to get used to.

Tipping procedures are also different.

The departure comes at a time when Instacart is working out its place in the world after dealing with some controversy, including changing its tipping procedures that led to shopper backlash.

The sky-tipping procedure was executed every ~9 min before December 14 , 2013 and is executed every ~8 min after that, requiring ~40 s to complete the one procedure.

To perform the tongue-tip procedure, three small and identical Petri dishes were set before the subjects, one containing 10 ml water, another containing 10 ml of 5 mM citric acid, and the third containing 10 ml of 15 mM citric acid.

The tip procedure resulted in virtually identical rates for both large and small subunit genes (6.5 × 10-9 substitutionsbstitutions per synonymous site per year; Additional file 5C).

Thus, very similar estimates of the absolute rate of amino acid substitution were obtained despite the different assumptions made by the tip procedure and the PL method.

Estimates of the absolute rate of amino acid substitution for AGPase subunits obtained by the penalized likelihood (PL) method were very similar to those obtained using the tip procedure.

This approach is called the tip procedure since it involves only terminal branches (Methods), and it revealed that the average rate of evolution for the large subunit was 2.7-fold faster than that of the small subunit.

These are: Tkan1: d (CTGCGTGCAATCCATCTTGTTC) and Tkan2: d (CCTTCTTGACGAGTTCTTCTG) DNA from chosen BAC clones were purified using the Qiagen tip procedure described earlier [ 7, 14], and injected into zebrafish eggs as described earlier [ 4, 9].