Suggestions(1)
Exact(2)
This includes collaborating with sales executives, account managers, and account service representatives, as well as underwriting, network, marketing, product, and operations teams to ensure that Aetna International has the right combination of products, services, promotional tools, and price points for this unique segment.
The main-chain of the N-terminal residues Asp3A-Leu9A of Evasin-1 interacts with the side-chain of this unique segment of CCL3.
Similar(58)
UPS 2.0 is an updated from the previous platform, which is a probe design tool for identifying the unique segment in each submitted sequence in a query dataset, or the unique segment of input sequences in the user-defined background.
We therefore studied specific expression of full-length hSef by in situ hybridisation using probes specific for the unique segment of the long isoform.
In in situ hybridisation the cDNA template for the riboprobe was designed from the unique segment of the long isoform (AF494208) and incorporated a T7 and T3 promoter (Yorkshire Biosciences, York, UK).
To confirm that the putative IS element is a single copy and does not represent a segment flanked by two copies PCR was performed with primers that hybridise in the unique segments on either side (5' –TCCCTTGTGCTAGTGTCATAG -3' and 5'-AGGCTTGAGTCAGATTAAGTCT-3').
We need new approaches that let businesses tap into the potential of this unique population segment.
This paper proves that for any member of the family, a unique segment of that spiral can be found that matches given two-point G1 Hermite data.
What is more, given two such circles, there is on any A-orbit a unique segment that meets them both orthogonally; the length of this hyperbolic geodesic segment does not depend on the A-orbit chosen, so it is very reasonable indeed to call our two circles parallel.
Operating managers were empowered to develop unique business models and launch derivative products by themselves to best serve each unique segment; and in the process, disrupted and competed with one another.
In the first module, GUSP (Generation of Unique Segment Pairs), we select a set of (n, r) unique segment pairs, which is defined as the segment set that satisfies the following conditions: (1) each segment length is n nucleotides, (2) all intended pairs of segments are in perfect match, and (3) the aberrant contiguous matching between any other segments is r bases less than the maximum.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com