Exact(1)
This tandem of P-copies could transpose en bloc, in what is called a "macrotransposition" [ 34].
Similar(55)
To the best of our knowledge, this tandem duplication of both codon 12 and 13 has not been described before in any cancer type.
This tandem configuration of activating domains merged into a single polypeptide chain the task of delivering two signals needed for the activation of naïve T cells.
These genes are oriented head-to-tail on chromosome 1q32; this tandem arrangement of similar genes suggests that they are homologues that have arisen by successive genomic duplication events over time.
An instance (originally from Jaitly et al. [ 2]) of a human tandem repeat appears below (Genbank: 10120313): CCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCCTCCGCCTTCTCATCCTCCTCCACTT CCTCCTCCTCCTCCTCCTCCCCTTCTCATCCTCCTCCTCTTCATCTACCC This tandem repeat consists of 35 approximate copies of the repeated pattern CCT.
It continued with the tandem of General Manager Terry Bradway and Coach Herman Edwards, who took over last season.
One combination that must get better is the tandem of Lindros and Fleury.
Chris Smalling and Daley Blind continue their run as the tandem of centerbacks.
The employed sequencing approach did not allow to obtain full length D4Z4 units; this was probably due to difficulties in assembling the sequences of this tandem array, and/or to underrepresentation of D4Z4 sequences during the amplification step needed for the sequencing process.
JOHN MADDEN This tandem reminds me of Loman and Kowalski in their pathos and three-dimensionality. MICHAELS Who do you give the edge to?
Figure 3 illustrates how the position of potential single-unit deletion or expansion of this tandem repeat (assuming a simple interunit recombination mechanism of creation) would affect the product ratio P1[B]/P1[A].
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com