Sentence examples for this search yielded from inspiring English sources

This search yielded a total of 29 articles.

This search yielded a total of 4998 results depicted in Table 1.

We first searched CNKI database to identify articles on turnover using broad turnover-related key words; this search yielded 2294 articles.

This search yielded a sequence located between −761 and −732 bp (5′CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3′), which includes an overlapping AP-2 like sequence, as a good candidate.

This search yielded 815 potentially relevant articles.

This search yielded the final collection of HSEs.

This search yielded no additional studies with the requisite data.

This search yielded 999, 579, 1000 and 314 homologues of BceR (RR), BceS (HK), BceA (NBD) and BceB (MSD), respectively.

Following this search yields Yelp reviews, PUA sites and bodybuilding advice forums lauding the spot as "the city's premier cougar bar" and "a cougar frenzy".

This search yields general funding options rather than specific grants, but it provides a starting point.

This search yield a total of 3,097 documents that were stepwise selected on the level of title, abstract and full text.