Sentence examples for they were forward from inspiring English sources

Exact(5)

"People who decorated their homes with Morris in the 1860s wanted their homes to reflect the fact that they were forward thinking," says Cann.

For example, the municipal representatives said that they were "forward thinking" and had regular contact with the regional cooperation body's civil servants [38].

For CquiOr118b, they were: forward, GTCGTTGCTTTTCCTGATGG; reverse, CACGGCATT CTCATATTTTACACT.

The primers for GABAB1 were forward 5′-GCCGCTGTGTCCGAATCTGCT-3′ and reverse 5′-CTGCGCGCCGTTCTGAGTGT-3′, and for GABAB2 they were forward 5′-TGGAGGCGTCTGTCCATCCGT-3′ and reverse 5′-GTCTTGCGTCAGCGTGCCCA-3′.

They were: forward primer 5'-GAG TTC CTG AGC GAG TGG-3' mapping in exon 1, and reverse: 5'-GCT CGT TGG AGA AGA GGA-3' mapping in exon 9. Metaphases from each cell line were prepared as per standard cytogenetic techniques.

Similar(55)

When the resort was commissioned, in the early 1960s, Breuer was an understandable choice for developers Eric and Sylvie Boissonnas: they were forward-thinking modern-art lovers who had a grand utopian plan to establish an original example of architecture and urban planning in France – a mountain resort with the feel of a city.

After the letter and tape were received, they were forwarded to the Marine Corps' inspector general, Brig.

Once the documents were in Washington, they were forwarded by the C.I.A. to the Pentagon, he said.

He investigated and found they were forwarded by a program, calling itself Jeem, that had not been seen before.

They were forwarded after 42 to 171 days for examination in the context of our project.

If a consensus over conflicts was not reached, they were forwarded to a third reviewer for resolution.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: