On the east they were bordered by the Elbe and the Bohemian mountains; on the west, beyond the Rhine, they included the districts afterward known as Alsace and Lorraine.
As a result of using the Mint-2 kit, all amplified cDNAs were bordered at their 5′ end by the M1 sequence (AAGCAGTGGTATCAACGCAGAGT) and the SfiIA restriction site (GGCCATTACGGCC) while, at their 3′ end, they were bordered by the SfiIB restriction site (GGCCGAGGCGGCC) and the M1 sequence.
defer.add img); Turn over cards, only when both of their cards that they were bordered on, have both been placed on the "go-to/from" pile.
Their supporters began this match by singing about relegation but, by the end, the dark humour had made way for open dissent and the clear sense they are bordering on mutiny.
Even so, it was refined to the point that his looks are becoming so pure and distinctive they're bordering on the iconic.
Iran may be excused for worrying about Iraq and Afghanistan, since they are bordering states, but it remains a mystery why Tehran meddles in the affairs of Lebanon, Syria, Egypt, Bahrain, Yemen -- and even Morocco, which severed relations with Iran this spring.
Where lines cross water, parks, and each other, they are bordered in white.
They are bordered by lush courtyards and cobblestone streets bearing names of their real-world counterparts.
They are bordered on the south by the Ferrar Glacier and on the north by the Priestley Glacier and the Deep Freeze Range.
