thereby amplified

USAGE SUMMARY

The phrase "thereby amplified" is correct and usable in written English.
It can be used to indicate that something has been increased or enhanced as a result of a specific action or event. Example: "The sound quality of the recording was poor, but the new software thereby amplified the audio, making it much clearer."

✓ Grammatically correct

Science

News & Media

Academia

Human-verified examples from authoritative sources

Exact Expressions

2 human-written examples

In TIVE cells, we identified multiple cancer associated TFs that were down-regulated and thereby amplified the regulatory effects of miR-K12-11 miR-K12-11 miR-K12-11

BMC Genomics

The C1GALT1C1 gene is composed of a single exon and was thereby amplified by the polymerase chain reaction using the forward primer 5' ATGCTTTCTGAAAGCAGCTCC 3' and the reverse primer 5' TCAGTCATTGTCAGAACCATTTGG 3'.

eLife

Human-verified similar examples from authoritative sources

Similar Expressions

58 human-written examples

He took his radio and TV shows with him, thereby amplifying his call.

Massachusetts Institute of Technology

Indeed, these dimensions of advantage appear to be clustering more tightly together, each thereby amplifying the effect of the other.

The New York Times

During tapping mode, the nonlinear tip-sample force activates the internal resonance and thereby amplifies the out-of-phase resonant mode.

Sensors and Actuators A: Physical

But it seemed as likely to broaden the anti-American insurgency as to diminish it, and thereby amplify the growing murmur that here was a new Vietnam in the making.

The Guardian

Our goal with EDG is to be on the forefront of this revolution, to nurture the entrepreneurial spirit, and to thereby amplify the process of biotech innovation for years to come.

Science Magazine

In the Cheekwood Mansion Art Museum on site there are yet more pieces, the "Light Shower" with its 1,400 lights is compressed into a room of great verticality, thereby amplifying its effect.

Huffington Post

The concomitant MSC induced reduction of PAI-1 and increase of tPA in astrocytes of the IBZ thereby amplify tPA activity which contributes to neurite outgrowth.

Plosone

One advantage of lymphocytes is their ability to divide in response to antigen, thereby amplifying the therapeutic response.

Arthritis Research and Therapy

The growing tumor secretes more pro-osteoblastic factors, thereby amplifying the formation of woven bone and perpetuating the vicious cycle [ 4, 50].

Arthritis Research and Therapy

Expert writing Tips

Best practice

Use "thereby amplified" when you want to clearly indicate that a specific action or event directly leads to an increase or enhancement of something. Ensure the cause-and-effect relationship is evident in your sentence.

Common error

Avoid using "thereby amplified" in simple sentences where a more direct verb would suffice. This phrase is best suited for complex relationships where the amplification is a distinct and important consequence.

Linguistic Context

The phrase "thereby amplified" functions as an adverbial phrase that modifies a verb or clause, indicating that the action described in the main clause directly results in an increase or enhancement. Ludwig confirms that this phrase is usable in written English.

Expression frequency: Rare

Frequent in

Science

67%

News & Media

17%

Academia

16%

Less common in

Formal & Business

0%

Encyclopedias

0%

Wiki

0%

Ludwig's WRAP-UP

In summary, "thereby amplified" is a formal adverbial phrase used to indicate that a preceding action directly causes an increase or enhancement. Ludwig AI indicates that it is grammatically correct and usable. While its frequency is rare, it is primarily found in scientific, academic, and news contexts. When using this phrase, ensure that the causal relationship is clear and that a more straightforward alternative isn't more appropriate. Consider alternatives like "thus enhanced" or "consequently increased" for simpler constructions.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

thus enhanced

Replaces "thereby amplified" with a more concise expression of direct enhancement.

consequently increased

Emphasizes the result is a direct consequence and increase.

resulting in amplification

Rephrases to highlight the process leading to amplification.

leading to greater intensity

Focuses on the increased intensity as the outcome.

in turn heightened

Suggests a sequential effect, with heightened as the result.

subsequently augmented

Uses a more formal tone to describe the augmentation.

as a result, boosted

Highlights the boosting effect due to the prior action.

which in effect magnified

Stresses the magnifying effect of the initial action.

henceforth expanded

Implies an expanding or growing effect from that point forward.

and so intensified

Connects the intensification directly to the prior clause.

FAQs

How can I use "thereby amplified" in a sentence?

Use "thereby amplified" to show a direct cause-and-effect relationship where something is increased or enhanced as a result of a previous action. For example, "The reduction in friction thereby amplified the machine's efficiency."

What's a simpler way to say "thereby amplified"?

You can use simpler alternatives like "thus enhanced" or "consequently increased" depending on the context. These alternatives might be more appropriate for less formal writing.

Is "thereby amplified" appropriate for formal writing?

Yes, "thereby amplified" is suitable for formal and technical writing, particularly in scientific or academic contexts, where precise language is important.

What is the difference between "thereby amplified" and "and amplified"?

"Thereby amplified" indicates a direct causal relationship, meaning the amplification is a direct result of the preceding action. "And amplified" simply adds amplification as another characteristic without necessarily implying a direct cause.