Collette the waitress is a parody of Cheers character Diane Chambers, and the "theme sequence" for Flaming Moe's, is a direct parody of the famous Cheers theme.
Although showing on consecutive days and not billed as part of a themed sequence, BBC1 next week launches two new shows offering a broadcasting equivalent of what art curators like to call a "conversation" between pictures hanging on opposite walls.
On transcription, messages were coded under similar themes, sequenced and patterned to obtain relevant narratives and anecdotes.
On November 17 , 2004 a teaser DVD named "Air prelude" was produced containing interviews with the anime's cast, clean opening and ending theme video sequences, and promotional footage of the anime itself; it was a limited edition DVD, with only 20,000 copies produced.
Upon listing the probes most highly correlated with probe pm6 from the 31846_at probe set (base sequence TCCTGGACTGAGAAAGGGGGTTCCT) it becomes apparent that there is a common theme: each probe contains a sequence of four or more consecutive Gs.
With Gann as your guide, you'll be able to follow the progress of the Well-Tuned Piano through its "clouds", themes and sequences.
He offers his own thumbnail history of modern jazz in formal terms, speaking of the "freedom" that emerges from the musicians' repudiation of such traditional frameworks as themes, chord sequences, and a steady beat.
Usually, at about the midpoint of every trip, themes and sequences begin to take shape and we start fine-tuning and filling in holes.
While the early Treehouse of Horror episodes featured a Halloween themed opening sequence, the later ones only included the title and the "created by" and "developed by" credits.
Therefore, the emerging themes and sequence will be described separately.
