Sentence examples for theme sequence from inspiring English sources

Exact(1)

Collette the waitress is a parody of Cheers character Diane Chambers, and the "theme sequence" for Flaming Moe's, is a direct parody of the famous Cheers theme.

Similar(59)

The theme sequences are not used consistently throughout the series since the episode producers decided to prioritize story-telling to their use which helped keep the plot within thirteen episodes.

Although showing on consecutive days and not billed as part of a themed sequence, BBC1 next week launches two new shows offering a broadcasting equivalent of what art curators like to call a "conversation" between pictures hanging on opposite walls.

On transcription, messages were coded under similar themes, sequenced and patterned to obtain relevant narratives and anecdotes.

Upon listing the probes most highly correlated with probe pm6 from the 31846_at probe set (base sequence TCCTGGACTGAGAAAGGGGGTTCCT) it becomes apparent that there is a common theme: each probe contains a sequence of four or more consecutive Gs.

While the early Treehouse of Horror episodes featured a Halloween themed opening sequence, the later ones only included the title and the "created by" and "developed by" credits.

On November 17 , 2004 a teaser DVD named "Air prelude" was produced containing interviews with the anime's cast, clean opening and ending theme video sequences, and promotional footage of the anime itself; it was a limited edition DVD, with only 20,000 copies produced.

Therefore, the emerging themes and sequence will be described separately.

With Gann as your guide, you'll be able to follow the progress of the Well-Tuned Piano through its "clouds", themes and sequences.

He offers his own thumbnail history of modern jazz in formal terms, speaking of the "freedom" that emerges from the musicians' repudiation of such traditional frameworks as themes, chord sequences, and a steady beat.

Usually, at about the midpoint of every trip, themes and sequences begin to take shape and we start fine-tuning and filling in holes.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: