When kidney graft survival analysis was stratified for anti-HLA antibodies presence and their specificities, they found that both donor-specific (49%) and non-donor-specific antibodies (70%) were associated with worse graft survival than antibody-negative patients (83%).
EL analyzed the results of these blast searches to identify various group-specific proteins and confirmed their specificities by means of PSI-blast and genomic blasts.
Gene-specific primers were designed using Primer 5.0, and their specificities were checked by the melting curves of the RT-PCR products.
The primers were: LMW-i-F: TGAAGACCTTCCTCGTCTTTG, LMW-i-R: CTGTGAAATTTGCGCAACG. Gene-specific primers were designed using Primer 5.0 and their specificities were checked by the melting curves of the RT-PCR products.
Event-specific primers targeting the eight GM canola events were designed, and their specificities were confirmed using 14 GM events of maize, soybean, cotton, and canola.
A preliminary study of cloth characteristics, including scanning electron micrographs, shows their specificities towards particular media.
Their specificities depend on the pore shape, size, and chemical environments of the voids or channels.
Elderly can be one of these groups but require a special attention by specialists due to their specificities.
Cyclic voltammetry performed on the different NiTi-based electrodes highlights their specificities regarding electron transfer to a redox probe present in solution (here ruthenium III) hexamine).
Because the usability of single-stranded oligodeoxynucleotides depends on their efficiencies, as well as their specificities, analyzing their genotoxic off-target activities is important.
Though a large number of such proteins have been identified, their specificities and expression levels are not suitable for lignocellulosic bioethanol production.
