Sentence examples for the used restriction from inspiring English sources

Suggestions(1)

Exact(1)

Despite the absence of variation in the mouse reference genome, the additional optical mapping analysis by the Wellcome Trust Sanger Institute complemented the existing data from the Schwartz laboratory in an effort to detect discordance caused by incomplete digest, and to provide a mapping framework in regions lacking target sites for one of the used restriction enzymes.

Similar(59)

The early genetic maps used restriction fragment length polymorphism (RFLP) markers [ 7- 9].

The following parameters were used: restriction endonuclease BfaI (NEB), TE preamplification primer: 5' cagaaaaatgaatgacaagttcatccacttctcctg 3', and TE selective primers: 5' caagttcatccacttctcctggcct 3'.

In addition, numerous commonly used restriction enzyme sites exist on the backbone of the binary vector, limiting the construction strategy with regard to the use of restriction sites.

Four copies of 2*LRE, 2*19RE or 2*REm were cloned into the 3′UTR of the reporters using restriction sites XbaI and NotI.

Secondly, the method uses restriction sites that may not be available in an amplified repeat unit.

I think this position renders the Use Restriction meaningless.

And, Fourth, if the Use Restriction is waived, what happens to the tenants of that property?

This bypasses the problem of using restriction enzymes with the gene of interest.

In the hybrid generated by crossing C. farreri female with A. irradians male, the restriction patterns using restriction enzyme Hae III differentiate the maternal ITS from paternal ITS.

The respective PCR products were cloned in the target vectors using restriction enzymes SalI and PstI.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: