Your English writing platform
Free sign upSimilar(60)
The insert contained, from 5′ to 3′, the full-length, unaltered sequence of frGFP, the sequence CACCACCACCACCACCAC encoding the hexahistidine tag, and the noncoding sequence TAATAATAAAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTG.
The insert contained, from 5′ to 3′, the full-length, unaltered sequence of capA, the linker GGATCAGCAGGTTCCGCTGCTGGTTCTGGCGAATTC encoding Gly-Ser-Ala-Gly-Ser-Ala-Ala-Gly-Ser-Gly-Glu-Phe, the sequence encoding the full-length, unaltered frGFP, the sequence CACCACCACCACCACCAC encoding the hexa-histidine tag, and the noncoding sequence TAATAATAAAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTG.
Within stems I and II and a shortened form of stem IV, compensatory changes resulted in rates of cleavage equal to or greater than the unaltered ribozyme sequence.
In this case, Sfc6 (TFIIIC) is recruited, presumably through the unaltered B box sequences; however, it is not sufficient to counter the spread of pericentromeric heterochromatin.
A single allele was the same size as the unaltered ade2 -h7.5 tract; sequencing of this allele showed that it had a single nucleotide deletion, which reduces the size of the HRAS1 minisatellite insert in ADE2 from 301 bp to 300 bp and restores the correct reading frame (data not shown).
The number of reads mapped to the composite genome (which includes spliced ribosomal protein gene sequences) and to the unaltered human genome (hg18), and the number of reads overlapped with uniqueome ("mapped uniquely") for both are shown.
In the first, we use unaltered ("raw") sequence data in which different taxa exhibit either one or the other of the two different inversion configurations.
Precise deletion of the intervening sequence of a yeast tRNATyr ochre suppressor gene (SUP6) significantly reduced its suppressor activity relative to that of the unaltered gene.
In this dystopia, it is the unaltered humans who rule.
Importantly Glaxo should make available the unaltered raw data files.
For multi-hop WiNoCs, the unaltered Fast Broadcast module was used.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com