the transformants of

USAGE SUMMARY

The phrase "the transformants of" is correct and usable in written English.
It can be used in scientific or technical contexts, particularly in genetics or microbiology, to refer to organisms that have been genetically modified or transformed. Example: "The transformants of the bacterial strain exhibited increased resistance to antibiotics."

✓ Grammatically correct

Science

Human-verified examples from authoritative sources

Exact Expressions

17 human-written examples

50 mg/mL of ampicillin was always present to screen the transformants of E. coli.

Protein & Cell

As a result, PCR products containing two primer-introduced terminal sequences (5′CAGCCACCATCATCACCACCAC3′ and 5′TGCACGTAATTTTTGACGCACG3′) that are homologous to the region flanking lysis gene E expression cassette can be inserted into pOmni and substitute lysis gene E expression cassette by means of PCRRC strategy, and the transformants of recombinant vector can be selected automatically.

AMB Express

When necessary, 100 µg/ml of spectinomycin (Spc) (Sigma) or 5 µg/ml of chloromycetin (Cm) (Sigma) was used for S. suis transformants, and 50 µg/ml of ampicillin (Amp) (Sigma) was applied to screen the transformants of E. coli.

Plosone

Genes down-regulated by the miR-17 transformants, and up-regulated by the transformants of small interfering RNAs (siRNAs) corresponding to it were identified using Illumina HT12 microarrays and differential expression analysis (table S2).

Plosone

GFAT was successfully expressed in plasmids pREP3X-gfa1, pREP3X-gfat and pHsh-glmS in the transformants of S. pombe Δgfa1 and E. coli ΔglmS, and it complemented both GFAT gene deficient strains so that they could grow on the G- medium normally.

Plosone

On CMC plates, the pHX04 transformant demonstrated a higher endoglucanase activity than the transformants of pHX02.

BioMed Research International

Human-verified similar examples from authoritative sources

Similar Expressions

43 human-written examples

The transformant of ZEN by SMCD 2220-01 could be identified as zearalenone sulfate as revealed by LC ESI HRMS analysis (Fig. 8a).

AMB Express

#18: the primary transformant of Pubi-EXG1 (Taichung 65), #21-3 and #27-4: the self-progenies of the primary transformants of Pubi-EXG1 (Taichung 65), v: the vector transformed control plant.

Rice

The best transformants of each of the gene combinations were chosen.

AMB Express

The cellular DNA content of all transformants was checked by flow cytometry [ 18]; 7.7% of the transformants tested (1242 of 16203) were polyploid.

BMC Plant Biology

There are several possible explanations for the low enzyme activity and CGP accumulation in the cphA transformants of R. oryzae.

Applied Microbiology and Biotechnology

Expert writing Tips

Best practice

When describing transformants, ensure you clearly specify which organism or cell type has been transformed and the specific genetic modification that has occurred.

Common error

Avoid using the phrase "the transformants of" without specifying the original organism or the purpose of the transformation. This can lead to ambiguity and confusion in scientific writing.

Linguistic Context

The phrase "the transformants of" functions as a prepositional phrase, often used to specify the origin or source organism/cell line that has undergone transformation. It indicates a relationship between the transformed entity and its original form, as seen in Ludwig examples.

Expression frequency: Common

Frequent in

Science

100%

Less common in

News & Media

0%

Formal & Business

0%

Academia

0%

Ludwig's WRAP-UP

In summary, the phrase "the transformants of" is a grammatically correct and commonly used prepositional phrase, primarily within scientific contexts. As Ludwig AI confirms, it serves to denote a genetically modified entity in relation to its original state. While alternatives like "modified versions of" exist, this phrase is favored for its precision in scientific discourse. Ensure clarity by specifying the organism transformed and the modification details to avoid ambiguity. Its frequency suggests it is a staple in scientific literature, emphasizing the importance of understanding its proper usage.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

the modified versions of

Emphasizes the alteration or modification aspect of transformants.

the genetically altered forms of

Highlights the genetic manipulation involved in creating transformants.

the engineered variants of

Focuses on the deliberate engineering process.

the recombinant types of

Stresses the recombination of genetic material.

the transgenic instances of

Emphasizes the transfer of genes between organisms.

the transfected derivatives of

Highlights the process of introducing genetic material into cells.

the clones of transformed cells

Specifies that transformants are clones.

the strains with introduced genes

Focuses on the introduction of new genes into the transformants.

the organisms expressing foreign dna

Specifies the expression of DNA from a foreign organism.

the population of modified cells

Generalizes the transformants as a group of altered cells.

FAQs

How can I use "the transformants of" in a sentence?

You can use "the transformants of" to describe genetically modified organisms. For example, "The transformants of E. coli showed increased antibiotic resistance."

What's a good substitute for "the transformants of"?

Alternatives include "the modified versions of" or "the genetically altered forms of", depending on the context.

Is it better to say "transformed cells" or "the transformants of"?

Both are correct, but "the transformants of" is often used when you want to emphasize the relationship to the original, untransformed organism or cell.

What is the context where "the transformants of" is most appropriate?

"The transformants of" is most appropriate in scientific and technical writing, especially when discussing genetic engineering, molecular biology, or microbiology.