Sentence examples for the terminal target from inspiring English sources

Exact(1)

The orphan RR protein CtrA (shown in blue in Fig. 4A) scores negatively with all kinases, consistent with a previous report that it is the terminal target of a phosphorelay and gets phosphorylated by an Hpt domain phosphotransferase rather than by any of the orphan SK proteins [28].

Similar(59)

In Table 5 we use PERCENTPATH to denote the percentage of the shortest paths from transcription factors to the terminal targets that either originate or go through LSCC, and PERCENTLENGTH to denote the similar percentage for the sum of lengths of shortest paths.

Ideally, Aumann's proofs that "like-minded" decision makers "cannot agree to disagree," provided they have the same information knowledge (encoded by priors and likelihoods), should be the practical terminal target of the trajectories shown in Figure 1.

As previously reported (14), the nerve terminal targeting of hSynI was not affected by the Q555X mutation.

In particular, the hypoglossal terminals target the polar regions of the intrafusal fibers of a number of the masseter neuromuscular spindles [ 3].

The 5′ terminal targeting fragment was amplified using AAGGGATCCAATACCTTGAAATTAATAATCCATC and TTAACTGCAGCTGATGCTGTC, and the 3′ terminal fragment was amplified using CTGATATTGCCTCATTCCATGGCTTCG and TTGGTGATTGTGGGGTACCAGTAC.

My partner, Matt, had just flown out of Istanbul Ataturk Airport's international terminal, the same terminal targeted by attackers.

TT, terminal target.

Li, X. & Coffino, P. Degradation of ornithine decarboxylase: exposure of the C-terminal target by a polyamine-inducible inhibitory protein.

Subsequently, a proteinyl enzyme thioester intermediate is formed with concomitant release of the C-terminal target protein moiety.

It is noteworthy that the C-terminal target on 18.5 kDa MBP did undergo a disorder-to-order (specifically α-helical) transition, though, in vitro [ 39].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: