Sentence examples for the suggested sequence from inspiring English sources

Taking into consideration variation in environmental conditions at a regular construction season of late spring and summer in West Virginia, the suggested sequence was able to achieve uniform setting times as well as thermal properties while being placed along an entire working day.

In this manner, the user can choose between selecting the suggested sequence, or another complete sequence that he/she considers of better orthology, or discarding the OTU from this gene.

Both feature sets and their combinations yielded a very high accuracy, which is as good as the previously suggested sequence motif and k-mer based method.

For postmenopausal women, there is a flow chart with the medications available free of charge through the SUS, and a suggested sequence for the use of these medications.

(The most frequently suggested sequence of events involves Harvey going out on his own, perhaps as a producer, while Bob stays to run Dimension, Miramax's profitable youth- and genre-movie offshoot, though recent reports that the Weinsteins' nemesis Michael Eisner will step down as head of Disney has made the speculations even wilder and murkier).

Among the 15 suggested sequences, the one had the least dissociation constant (K d) was chosen (35.6 ± 2.9 nM) and synthesized by Technology Gene company that its sequence is as follows: 5′ATCCGTCACACCTGCTCTATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGATGGTGTTGGCTCCCGTAT3′.

Based on the observations gathered from the sequence space analysis we suggested sequence space-based coreceptor prediction methods.

However, three different colonies from the patient HC2 had divergent patterns of hybridization on the CGH array containing the H99 genome, suggesting sequence heterogeneity.

The suggested taxonomic sequence of the mud-building swallows has been recommended by at least two European taxonomic committees.

Traditionally, most students (∼80%) follow the suggested curricular sequence, where the genetics course is taken the semester before cell biology.

2) The reviewer suggests sequencing sorted nuclei to identify full-length APP copy number changes or perhaps flanking sequences towards assessing mechanisms of CNV generation.