Sentence examples for the specific reverse from inspiring English sources

To 97 μL of this mix was added 0.5 μL of Taq polymerase and 2.4 μL of the specific reverse primer.

In addition, a PCR product (HA+revC14) was amplified using the common forward primer with NotI recognition sequence+HA sequence and the specific reverse primer with NotI site.

The cDNA samples were mixed with 1× SYBR Green Master Mix and the specific reverse and forward primers, in a final volume of 20 μl.

When the specific reverse complementary sequence to the cIRK1 5'UTR at positions 61 41 was utilized as a primer for reverse transcription, a product of approximately 80 bases was generated from brain mRNA (Fig. 1C).

First amplification of each cDNA was performed starting from the specific reverse forward primer 5′-agaagaattcccgttgccatatca-3′ located in exon 5 and T18, while the nested PCRs were performed with RACE LINKER 5′-agcgaattctagatctcgaggtacct-3′ and the specific 5′-ataatgtcagcagaagaattcccgt-3′ located in the 4 5 exon junction.

The amount of the immobilized polymer layer, the rigid amorphous fraction, was obtained from the specific reversing heat capacity for both as-spun amorphous fibers and isothermally crystallized fibers.

The TFC-PSfdGO also exhibited the lowest specific reverse salt flux (Js/Jv = 0.19 g L-1) and a more favorable structural parameter (S = 130 μm) compared to GO-free membranes.

DinoSL was used as the forward primer paired with the gene specific reverse primers (Table 1).

Cxcl12α, β and γ cDNA sequences were amplified using the common forward primer 5'atattgcgcgcatggacgccaaggtcgtcgcc3' and the isoform specific reverse primers 5'tacctggagaaagctttaaacaagtaagggcccaatat3' for Cxcl12α, 5'gctttaaacaagaggctcaagatgtgagggcccaatat3' for Cxcl12β, and 5'cgacagaagaagagaaaggctgcccagaaaaggaaaaactaggggcccaatat3' for Cxcl12γ.

The PCR reaction was carried out using the forward primer 5'tgcccttcagattgttgcac3', common for all isoforms, and the isoform specific reverse primers 5'gctaactggttagggtaatac3', 5'cttgagcctcttgtttaa3', and 5'gctagcttacaaagcgccagagcagagcgcactgcg3' for Cxcl12α, Cxcl12β and Cxcl12γ, respectively.

In this study, we consider a manufacturer that has strategically decided to outsource the company specific reverse logistics (RL) activities to a third-party logistics (3PL) service provider.