Your English writing platform
Discover LudwigExact(5)
All of the samples were assessed using an atomic absorption spectrophotometer.
Quantity and quality of the samples were assessed using an Agilent 2100 Bioanalyzer.
All the samples were assessed using the same exposition parameters to avoid artefacts in the data analysis.
All of the samples were assessed using an atomic absorption spectrophotometer (Varian Spectra AA 200, GTA-100, Australia).
The leishmanicidal effects of the samples were assessed using a modified 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrasodium bromide (MTT) method [ 35].
Similar(55)
The crystallinity of the samples was assessed using differential scanning calorimetry and density measurements.
The electrochemical behaviour of the samples was assessed using open circuit potential, potentiodynamic polarization curves and scanning vibrating electrode techniques.
Cd content of the samples was assessed using a graphite furnace and atomic absorption spectroscopy in the chemical laboratory of the Iranian Center for Advanced Mineral Processing Research.
Cell proliferation in the samples was assessed using the Cell Proliferation Reagent WST-1 with OD450 nm proportional to the cell numbers according to the manufacturer's recommendations and as previously described (Cucchiarini et al. 2011; Venkatesan et al. 2012).
Total RNA in the samples was assessed using rp49 primers 5'agtatctgatgcccaacatcg3' and 5' ttccgaccaggttacaagaac3'. High fidelity pfu turbo enzyme (Stratagene) was used for all PCR reactions.
The frozen animals were cryosectioned into 40 μm slices, and the radioactivity content of the samples was assessed using quantitative whole body autoradiography (WBA) as previously described (Labarre et al, 1999).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com