Sentence examples for the same conditions have from inspiring English sources

Yet the same conditions have also produced numerous remedies.

Two men, under the same conditions, have nothing to say at all".

Some of the GCM results obtained under the same conditions have been already shown in Fujiwara and Miyoshi (2010).

The same conditions have been taken for normalizer gene S7 RNA polymerase having forward primer sequence 5' GGTGTTCGGTTCCAAGGTGA 3' and reverse primer sequence 5' GGTGGTCTGCTGGTTCTTATCC 3'.

Sputtered gold films of the same thickness and annealed under the same conditions had a hardness of 2.3 GPa.

Conversely, the triple-axis XRD revealed that thicker films grown under the same conditions had expanded lattices.

From the data in Table 1, we found that the selectivity order of the investigated cations on PASnMoP in the same conditions has the following sequence; La3+ > Sm3+.

With the help of retention modeling all substances could be separated independently from the batch and/or packing, using the same conditions, having high robustness of the experiments.

Electroporation of an inactive form of ets-1 (w375r) in the same conditions has no effect (data not shown).

The long tails of a lognormal distribution can result in flies in the same conditions having TA varying over a range of 4. This high variability increases standard errors for each compound measured, unless normalization is done.

Test pulse stimulation, given under the same conditions, had no effect on basal synaptic transmission.