Sentence examples for the right inversion from inspiring English sources

The primers were as follows (5' to 3'): Left-inv-R (TAAAGCATCCACATCTTTTAATGg C), Right-inv-F (TTTCTAAAGCATCAACATCTTTTAAAGg T), and CP-Left-inv-F (GCATGTGATTACTTGAAGGATAGAAGG) were used to characterize the left inversion, and Left-inv-R, Right-inv-F and CP-Right-inv-R (5'- AGATTTCCAGTGAGAGATGATAACAACA) targeted the right inversion.

† denotes the right pseudo inversion and (A)†≜AH AAH -1.

Injection drug users had less ankle flexion-extension right, inversion-eversion left and right, and total ankle motion than those who did not inject drugs (p <.05).

The optical consensus map also closes the putative sequence gap immediately to the right of the inversion, and in fact, approximately half of the sequence gaps in the reference genome (NCBI, build 35) are spanned by optical consensus maps.

He had undergone a total left-to-right inversion, down to the atomic scale; to survive, he had to include the inverse forms of amino acids in his diet).

This is because the right hand chords inversions change and move up.

Megf8 L1775P/L1775P have complete left-right inversion of heart looping.

Approximately one third of Megf8 −/− embryos demonstrate a complete left-right inversion of heart looping or embryonic turning.

Through homologous recombination, a ura4 + marker and a promoter-less kanMX ORF, together with a loxP site in between, were inserted at the right junction of the inversion.

The same experiment also minimizes a possible impact of genes within the complex rearrangement on the right border of the inversion, if there is at all an influence of this region on the phenotype.

As these inversions are part of the right replichore and as intra-replichore inversions are relatively rare [ 27], we assume that the current chromosomal architecture of C. resistens DSM 45100 resulted from a flip-flop of two consecutive inversions.