The reverse primers bind within the second coding exon of the mouse (5′-GGA CTC TCG CTG ATC CAC ATC C-3′) and the human AKT1 (5′-GTA GCC AAT GAA GGT GCC ATC-3′) cDNAs, respectively.
This function models the reaction whereby dissolved oxygen and haemoglobin combine to produce oxygen bound to haemoglobin, as well as the reverse reaction whereby bound oxygen reverts to dissolved oxygen.
The reverse primer binds to vector sequence left in intron 45 and the primers span the introduced mutation to produce a 740-bp product which can be cut by BglII to produce two, 524 and 216 bp, products (Fig. 1b).
The repeat-primed PCR is designed so that the reverse primer binds at different points within the repeat expansion to produce multiple amplicons of incrementally larger size, producing a characteristic sawtooth pattern with a 6-bp periodicity.
The forward primer binds at the boundary of the donor site of the pSPL3 vector and at the beginning of exon 2 of the DSPP gene, while the reverse primer binds at the middle of exon 4 of the DSPP gene.
The primers used for RT PCR were as follows: forward (binds to exon 1a, 5′-TTTTCATTTC TCACAAGGAC TGGGT-3′) and reverse (binds to exon 2, 5′-CTGGTGAGGA GTGCTCTGAG AGC-3′).
Pata, J.D., Stirtan, W.G., Goldstein, S.W. & Steitz, T.A. Structure of HIV-1 reverse transcriptase bound to an inhibitor active against mutant reverse transcriptases resistant to other nonnucleoside inhibitors.
Primers used in the experiment were designed using Primer3 software (http://primer3.sourceforge.net/) [ 89], whereas the forward primer ("TTTCGCTGAAGAGATGCAGA") binds at the last exon of Solyc11g005040 and the reverse primer ("TTGCATTTTCCACCACAGAA") binds at the first exon of Solyc11g00530 (Additional file 5).
Peptides designed for reverse discrimination bound M3P6 tighter than N2P2, further testing our technology.
Miller MT, Tuske S, Das K, DeStefano JJ, Arnold E. "Structure of HIV-1 reverse transcriptase bound to a novel 38-mer hairpin template-primer DNA aptamer". Protein Sci. 25, 46-55 (2016).
