Sentence examples for the repeated sequence from inspiring English sources

For example, Devonian rocks in Great Britain are often composed of the repeated sequence conglomerate-sandstone-siltstone-muddy siltstone with nodular carbonate.

For each informative locus identified, specific primers were designed to flank the repeated sequence and subsequently used to generate DNA profiles for the D. pini strains.

The repeated sequence that makes such an impression is when Ms. Shumake slowly, heavily walks forward on flat feet, her head lifting and her throat visibly tense; then, with a contraction, her torso lurches right forward.

Six copies of the repeated sequence occur in the full-size ORFs of strains 2308 and 9 941 (Figure 3).

We suggest that in the case of this class of secondary rearrangements the dicentric GCR broke at or near the repeated sequence.

[ (forward primer) ACGTGTATATATATATATATATAGAGG (reverse primer) ] Motif: Nucleotide composition of the repeated sequence.

The repeated sequences delight children as they can anticipate Goldilocks audacity and revel in the mounting disapproval.

Therefore, this research aimed to study the records of the repeated sequences and their energy concepts.

But then I thought Huntington's disease is primarily caused by the aggregation of proteins produced from the repeated sequences.

The repeated sequences included direct repeated sequence, inverted repeat sequence and homology sequence.

The repeated sequences are unique for the different avipoxviruses.