However, the GO terms for the targets do not match with the predicted target.
The shearing effect is caused by errors in the predicted target location.
Mutant vector was generated in Invitrogen by replacing the predicted target region with its reverse sequence (from AAGCACCAATAGCCTTGTTGGTC to CTGGTTGTTCCGATAACCACGAA).
Mutated vector was generated in Invitrogen by replacing the predicted target region with its reverse sequence (from ACUGCC to TGACGG).
Another issue is because the feature pyramid at the detection step is constructed around the predicted target location.
Finally, we assume that the network is composed of dynamic clusters, depending on the predicted target trajectory (see Figure 1).
where x sk is the smoothed target position at time kT, T is the sampling interval, x pk is the predicted target position, v sk is the smoothed target velocity, v pk is the predicted target velocity, a sk is the smoothed target acceleration, and a pk is the predicted target acceleration.
Similarly, we failed to show enrichment of either TF's antibody to the promoter of the predicted target DYRK1B (Figure 4B).
In other words, even when the classification failed, the predicted target direction was close to the actual direction.
Thus our findings indicate that a subset of the predicted target genes can be significantly repressed in experimental conditions.
At 17q25 lies the predicted target FASN.
