Sentence examples for the next library from inspiring English sources
What is the next Library Collection property on the horizon?
In the next library, smaller replacements for the P3 homo-phenylalanine residue were sought in combination with alternative N-terminal P4 capping groups that provided compensating hydrophobic interactions within the large S4 binding pocket.
A description of each directed evolution round including selection criteria, the mutations found in each sequenced variant, and mention of the variants chosen as templates for the next library generation can be found in Supplementary file 1. pET-Strep-PTE plasmids were transformed into E. coli BL21 (DE3) and grown at 37°C in TB medium containing 100 µg/ml ampicillin and 200 μM ZnCl2.
Three information retrieval storage structures are considered to determine their suitability for a World Wide Web search engine: The Wolverhampton Web Library — The Next Generation.
From a total of 61 loci tested from the next-generation library, four were monomorphic, 27 showed complex or nonspecific amplification, six showed high frequencies of null alleles, and 11 failed to amplify.
The next step involved library amplification using HiFi Library Amplification master mix (Kapa biosystems, MA) and BpmI-primer (CCGGCCCTGGAGTGTTGGGTGTGTTTGG).
Such a scheme would be particularly attractive if one could obtain significant SAR information in the process to guide the next round of library design.
B7 EDITORIAL A20-21 Electorals: Electorepairpair work; until the next Olympiad; shortchanging libraries.
About 1,100 crates of books, archives and photographic stills will be taken to the new library, next to the REP theatre, each day for three months, ahead of its official opening to the public on 3 September 2013.
Mariah took the next turn, at a library in Mahopac.
When I met him in the library the next day, he wasn't anything like his phone persona.
