Sentence examples for the luc from inspiring English sources

In other words, it's a welcome return to the Luc Besson of the 1990s.

Vaibhav Suri became India's newest grandmaster last Sunday when he won the Luc Open in Lille, France.

There's this great thing, Arthur and the Invisibles, the Luc Besson film.' So I started to give them things to aim at".

Her other recent movies include the Luc Besson sci-fi fantasy Lucy, which made $463m globally on a production budget of just $40m.

Vaibhav Suri became India's newest grandmaster last Sunday when he won the Luc Open in Lille, France, Dylan Loeb McClain writes in The New York Times.

The LUC activity was measured as described previously (Ohta et al., 2000).

We shall give similar results for the topological centre Λ GLUC) of the LUC-compactification GLUC of G.

The Luc-DENV-2 HTS assay allows screening for inhibitors of all steps of the viral life cycle.

Why would he play games like that?" Aylen also thanked Guy Versailles, a former Balcorp spokesperson who is now a member of the Luc-Beauregard Centre's advisory board.

The Luc-reporter constructs used in transfection experiments was: pmutCCAAT-cyclinB2LUC [24].

For truncated constructs, stop codon was removed by PCR before insertion into the Luc-tagged vector (Primer: 5'CCTCTAGACTGGATCCAGAGACAGGCTTGAGTG3').