Sentence examples for the full lengths from inspiring English sources
The full lengths (~ 1500 bp) of 16S rRNA genes were obtained by PCR using universal bacterial primers (24F: AGAGTTTGATCCTGGCTCAG and 1492R: TACGGYTACCTTGTTACGACTT) (Farris and Olson 2007).
By using the frequency range of 22.0 35.0 GHz, the maximum errors of evaluations are less than 0.38% and 1.04% of the full lengths of the pipes under test for the start and end points of the PWT sections, respectively.
Watch previews for both new episodes above and catch the full lengths tonight on VICELAND.
Prospectors staked claims and built cabins, and within a few years placer mining extended the full lengths of Cataract and Basin Creeks.
The full lengths or longer fragments of these genes were obtained after 3' and 5'-RACE.
The full lengths of those genes were obtained using 3' walking sequencing.
Walk toward the bay the full length of this street.
To see the full length version visit vogue.co.uk.co.uk
You can read the full length piece here.
That's the full length of the PATH tube".
The full length cDNA was named aleh1.
