Suggestions(2)
Exact(1)
"I helped do Jon Tester last time in Montana," he said, adding that, at the end of the Tester campaign, an average viewer was seeing pro-Tester spots twenty times a week.
Similar(59)
Tester adaptor (GTAACTAGGCCGTAATGGCCACTCTGCGTTGATACCACTG) and driver adaptor (GGCCGTAATGGCCTCGCTACCTTAGGA) were ligated to the 3' end of the first strand tester cDNA and driver cDNA, respectively.
By the end of the Accelerator, we were in a public beta with hundreds of beta testers from around the world.
At the end of the five years, testers keep one model of each ball for future reference and donate the remaining thousands to junior golf programs.
The BHA has said Al Zarooni's sentence was "the end of the beginning" and on Thursday sent testers to a second Godolphin stable in Newmarket - the yard of Saeed bin Suroor.
They ignored my medical records and my homo drag, but toward the end of the day I told the eye-tester I had double vision.
Testing comes at the end of the development process, and considering a QA as a tester therefore allows one to fall into the trap of including them only at the end.
He predicted a vote on Tester's amendment before the end of the year.
The moderately experienced researcher, Tester 2, seemed to dominate the ends of the scale more than Testers 1 and 3.
There was the Ultra Hand, a device with a gripping hand at the end of it; the Love Tester, a primitive electronic contrivance that purported to measure the level of ardor between a boy and a girl; the Beam Gun, which used a ray of light to hit simulated targets.
Two different adaptors (1 and 2R) were ligated to the 5' end of two aliquots of the tester DNA fragments.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com