Sentence examples for the base pattern from inspiring English sources

Only square-shaped InGaAs layers wrinkle almost in the same orientation every time and, therefore, this kind of structure has been used as the base pattern for the device assembling (Figure 4c).

A nucleotide is only changed at a particular HSP position if the base pattern containing that nucleotide has a better percentage identity than the base pattern corresponding to the currently assigned nucleotide.

Otherwise the nucleotide corresponding to the base pattern with the maximum percentage identity with the diploid progenitor is assigned at that position.

HANDS uses the fact that the base pattern must come from one of the subgenomes of the polyploid and consequently assigns the base pattern that is not assigned to any genome (due to low identity with the diploids) in step 3 to the genome designated as the distant genome.

For each HSP position, HANDS tabulates all nucleotides that are present in different base patterns assigned to an individual genome along with the base pattern(s) having the maximum percentage identity with the diploid genome containing that particular nucleotide.

For instance, if the pattern CAG is duplicated 10 times, it results in the sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG This can be rewritten as (CAG 10, where CAG is the base pattern, and 10 is the number of times the pattern is repeated, also known as the copy number.

For an input, it can also be separated into the similar patterns which have a linear relation γ with the base patterns.

While creating the base patterns, HANDS groups the same base patterns together keeping track of the number of reads supporting a particular base pattern.

In step 5, the base patterns discarded in step 4 are re-used to characterize bases at unassigned positions.

To remove the base patterns arising due to sequencing errors, HANDS calculates the base pairs (two consecutive HSPs) in each base pattern along with the number of reads supporting each pair.

Once a list of valid base patterns is obtained for the current gene, HANDS assigns the base patterns to individual genomes using the SBS data for the diploid progenitors.